View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_high_52 (Length: 210)
Name: NF11853_high_52
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_high_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 50 - 192
Target Start/End: Original strand, 14501398 - 14501540
Alignment:
| Q |
50 |
accatagatgacatgagctcatgaacattactttgttatatgtgaaatttagggaatcagcaggatgtggtcatcaatcaaatatgcctagcttcatgaa |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14501398 |
accatagatgacatgagctcatgaccattactttgttatatgtgaaatttagggaatcagcaggatgtggtcatcaatcaaatatgcctagcttcatgaa |
14501497 |
T |
 |
| Q |
150 |
tactagccacataaatttcttgtattcttgttatttatttatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14501498 |
tactagccacataaatttcttgtattcttgttatttatttatg |
14501540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University