View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_low_28 (Length: 398)
Name: NF11853_low_28
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 18 - 384
Target Start/End: Complemental strand, 39775982 - 39775616
Alignment:
| Q |
18 |
gagatcataggagaatttgggaaaagtccttgaacccgctaaggattctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775982 |
gagatcataggagaatttgggaaaagtccttgaacccgctaaggattctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgctt |
39775883 |
T |
 |
| Q |
118 |
gggcgcattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaacatcccttgtctggttacgttgttttatacgatagctttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775882 |
gggcgcattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaaaatcccttgtctggttacgttgttttatacgatagctttga |
39775783 |
T |
 |
| Q |
218 |
attggtaagtggaaaaaatcttcgtcattgtcaacaattggtaagatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatga |
317 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775782 |
attggtaagtggaaaatatcttcgtcattgtcgacaattggtaagatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatga |
39775683 |
T |
 |
| Q |
318 |
tttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgcacaaacatttcat |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775682 |
tttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgcacaaacatttcat |
39775616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University