View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_low_32 (Length: 365)
Name: NF11853_low_32
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 149 - 348
Target Start/End: Original strand, 6991148 - 6991352
Alignment:
| Q |
149 |
taatgtcaagaccaatgtattggctcgaaaccctatttatctaacacagtac-----ccaaatgtcttatgcgaaaagttatcaaaagattgactgaacg |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6991148 |
taatgtcaagaccaatgtattgggtcgaaaccccatttatctaacacattacattacccaaatgtcttatgcgaaaagttatcaaaagattgactgaacg |
6991247 |
T |
 |
| Q |
244 |
ttaaattataggccacgacttatcaatttaatatgtctaaagcaattaactagtgaacagtaatttcagttctcactctcctcttcggaaatggcggcga |
343 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6991248 |
ttaaattataggttacgactaatcaatttaatatgtctaaagcaattaactagtgaacagtaatttcagttctcactctcctcttcggaaatggcggcga |
6991347 |
T |
 |
| Q |
344 |
gctat |
348 |
Q |
| |
|
||||| |
|
|
| T |
6991348 |
gctat |
6991352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 113
Target Start/End: Original strand, 6990906 - 6991001
Alignment:
| Q |
18 |
ataacttatttttactagtttacaatggtgttcgataaattaattgaagtaacnnnnnnnnnnnnnatctaaattttatgcttgcaatcttaattg |
113 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6990906 |
ataacttatttttactaatttacaatgatgttggataaattaattgaagtaacattttcattttttatctaaattttatgcttgcaatcttaattg |
6991001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University