View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_low_44 (Length: 243)
Name: NF11853_low_44
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_low_44 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 59 - 243
Target Start/End: Original strand, 24327558 - 24327748
Alignment:
| Q |
59 |
gctgcattttgtggactagttaaatatggtgaaagtagttaaatttacctatatttgagaccagaacannnnnnngtatatagtcaaaaccagataaatt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24327558 |
gctgcattttgtggactagttaaatatggtgaaagtagttaaatttacctatatttgagaccagaacatttttttgtatatagtcaaaaccagataaatt |
24327657 |
T |
|
| Q |
159 |
acatatagtttctattatgcaacctagtatat-catatagt-----ttttataaaatgccacttcacttgcctaaattaacaatatcatac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24327658 |
acatatagtttctattatgcaacctagtatatgaataaggtaacagtcttataaaatgccacttcacttgcctaaattaacaatatcatac |
24327748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University