View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_low_47 (Length: 240)
Name: NF11853_low_47
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 89 - 226
Target Start/End: Original strand, 38039059 - 38039196
Alignment:
| Q |
89 |
tcccaacactagaagaaatgttaagaccaaacttggcaaaacaatcaacaactttatttactttccaatgcacatgaataacagaccaagaagacaactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039059 |
tcccagcactagaagaaatgttaagaccaaacttggcaaaacaatcaacaactttattaactttccaatgcacatgaataacagaccaagaagacaactg |
38039158 |
T |
|
| Q |
189 |
ctcgaggagatccctaatctggataaaatggctggtgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38039159 |
ctcgaggagatccctaatctggataacatggctggtgt |
38039196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University