View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_low_55 (Length: 220)
Name: NF11853_low_55
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 40283920 - 40283741
Alignment:
| Q |
24 |
ttatacattggaattttatataaatgtacgtagaaatctaataaaaaactcattataaaaaacttgttaacgtatataggttctatcttgaatttaaaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283920 |
ttatacattggaattttatataaatgtacgtagaaatctaataaaaaactcattataaaaaacttgttaacgtatataggttctatcttgaatttaaaaa |
40283821 |
T |
 |
| Q |
124 |
atttaacatatccatatcctatcacatcggcactatgtattcggacttagtagaccgagacacagtgctgctgctgcatc |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283820 |
atttaacatatccatatcttatcacatcggcactatgtattcggacttagtagaccgagacacagtgctgctgctgcatc |
40283741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University