View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_103 (Length: 213)
Name: NF11854_high_103
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_103 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 28035974 - 28036153
Alignment:
| Q |
20 |
gctgtggctgttgatgttgatgttgtgctttacaacatcgttggcattatcttctttagaatccttactattatttccctttatggctattgtgttagag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035974 |
gctgtggctgttgatgttgatgttgtgcttttcaacatcgttggcattatcttctttagaatccttactattatttccctttatggctattgtgttagag |
28036073 |
T |
|
| Q |
120 |
atgacattatgcatttggttagatgtttgattagtacctgggtgagcaacaagcttataatcttcatgagcacctttgct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036074 |
atgacattatgcatttggttagatgtttgattagtacctgggtgagcaacaagcttataatcttcatgagcacctttgct |
28036153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University