View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_19 (Length: 606)
Name: NF11854_high_19
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 508 - 596
Target Start/End: Complemental strand, 25517305 - 25517219
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttccaattgtttttggcttcnnnnnnnnngtttaaagaagcattgtcattttccctttg |
596 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25517305 |
ggttttctgttttgcttgattttgacatgtttcttattgtttttggcttc--aaaaaaagtttaaagaagcattgtcattttccctttg |
25517219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 25525529 - 25525487
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttccaattgtttt |
550 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
25525529 |
ggttttctgttttgcttgatttttaaatgtttccaattgtttt |
25525487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 26086260 - 26086218
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttccaattgtttt |
550 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
26086260 |
ggttttctgttttgcttgattttaaaatgtttccaattgtttt |
26086218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 508 - 549
Target Start/End: Complemental strand, 26069148 - 26069107
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttccaattgttt |
549 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
26069148 |
ggttttctgttttgcttgattttaaaatgtttccaattgttt |
26069107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 46430799 - 46430760
Alignment:
| Q |
56 |
ctgtgacaacagttcaaccattaagctgtcaaaaaatcct |
95 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
46430799 |
ctgtgacaacagttcatccattaagctgtcaaagaatcct |
46430760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 9601375 - 9601333
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttccaattgtttt |
550 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
9601375 |
ggttttctgttttacttgattttaaaatgtttccaattgtttt |
9601333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 542
Target Start/End: Complemental strand, 9604778 - 9604744
Alignment:
| Q |
508 |
ggttttctgtttttcttgattttgacatgtttcca |
542 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9604778 |
ggttttctgtttttcttgattttgaaatgtttcca |
9604744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 118
Target Start/End: Original strand, 1374119 - 1374180
Alignment:
| Q |
57 |
tgtgacaacagttcaaccattaagctgtcaaaaaatcctgtcctccacggaagaagcaaaca |
118 |
Q |
| |
|
||||| |||||||| || |||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
1374119 |
tgtgataacagttccacaattaagttgtccaaaaatcctgttatgcacggaagaagcaaaca |
1374180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University