View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_56 (Length: 306)
Name: NF11854_high_56
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 14132356 - 14132068
Alignment:
| Q |
1 |
cagtactagccagactggcctacaacgaaatctacttggaataggttgtatcatgc----cgtcaacttgatcagaaattggaaactagaaatctatata |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132356 |
cagtactagccagactggcctacaatgaaatctacttggaataggttgtatcatgcatgccgtcaacttgatcagaaattggaaactagaaatctatata |
14132257 |
T |
 |
| Q |
97 |
aagtaattgttatttggttgtaataattttctagtaactttacaatatcgttacgttgatgtcccccaaaaggcacgtctcttccatgtacttgcgcttg |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14132256 |
aagtaattgttttttggttgtaataattttctagtaactttacaatatcgtt-----gatgtcccccaaaaggtacgtctcttccatgtacttgcgcttg |
14132162 |
T |
 |
| Q |
197 |
tcactagcaacacttattgataaagctgattttcattgaagtactactgtact--atatatatgctaccttactcaagatcattttagtgaatc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132161 |
tcactagcaacacttattgataaagctgattttcattgaagtactactgtactagatatatatgctaccttactcaagatcattttagtgaatc |
14132068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University