View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_74 (Length: 269)
Name: NF11854_high_74
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 47469527 - 47469275
Alignment:
| Q |
1 |
acattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaagtaatagaatctattcttaaaatttgttaggaagtggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469527 |
acattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaagtaatagaatctattcttaaaatttgttaggaagtggtag |
47469428 |
T |
|
| Q |
101 |
gtaggtactagtgtttttgatttggtgttttgaatgaatcacagatgggagagcttaagaagttggttgaagagggaaagattaagtacataggattatc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469427 |
gtaggtactcgtgtttttgatttggtgttttgaatgaatcacagatgggagagcttaagaagttggttgaagagggaaagattaagtacataggattatc |
47469328 |
T |
|
| Q |
201 |
tgaggctagtactgatacaatcagaagggcacatgctgttcatcccattactg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469327 |
tgaggctagtactgatacaatcagaagggcacatgctgttcatcccattactg |
47469275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 253
Target Start/End: Complemental strand, 47473706 - 47473607
Alignment:
| Q |
154 |
cttaagaagttggttgaagagggaaagattaagtacataggattatctgaggctagtactgatacaatcagaagggcacatgctgttcatcccattactg |
253 |
Q |
| |
|
|||||||| |||| ||||||||||| ||||||| || ||| ||||||| || || |||||||||| || || || ||||||||||||||||| |||| |
|
|
| T |
47473706 |
cttaagaaactggtggaagagggaaaagttaagtatattggactatctgaagccagccctgatacaataaggagagcgcatgctgttcatcccatcactg |
47473607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University