View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_75 (Length: 264)
Name: NF11854_high_75
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_75 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 248
Target Start/End: Original strand, 35170508 - 35170744
Alignment:
| Q |
12 |
agagagggtttgaatgatacggattggaaaacacgtaaagcggcttccgttgcgttgggacaaattgctttgactcgtgcttcgttcttgtcgtctttga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170508 |
agagagggtttgaatgatacggattggaaaacacgtaaagcggcttccgttgcgttgggacaaattgctttgactcgtgcttcgttcttgtcgtctttga |
35170607 |
T |
 |
| Q |
112 |
gggcttcttgtattcattctcttgattcatcgaggtttgataaggtggttactcactctctgtttttgacattattagtattgcatttctcaatattcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170608 |
gggcttcttgtattcattctcttgattcatcgaggtttgataaggtggttactcactctctgtttttgacattattagtattgcatttctcaatattcat |
35170707 |
T |
 |
| Q |
212 |
gtttctcattaactaacttatatgtgtatatatgaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170708 |
gtttctcattaactaacttatatgtgtatatatgaat |
35170744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University