View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_77 (Length: 262)
Name: NF11854_high_77
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 11630576 - 11630682
Alignment:
| Q |
13 |
taggcaatttttcttgtactttttgtatggttttagcaacttgtgtcatgtgatctctagttgttttgacatgctttgctgtttttattaatatatcact |
112 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11630576 |
taggcaatttttcttgtatattatgtatggttttagcaacttgtgtaatgtgatctctagttgttttgacattctttgctgtttttattaatatatcact |
11630675 |
T |
|
| Q |
113 |
cacaaca |
119 |
Q |
| |
|
||||||| |
|
|
| T |
11630676 |
cacaaca |
11630682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 168 - 262
Target Start/End: Original strand, 11630681 - 11630775
Alignment:
| Q |
168 |
catggtataaatcttttggatttaacccctttggtttctgagggaaatgggttgtggtaatctggagcaataattgtttcagctaagatttaaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
11630681 |
catggtataaatcttttggatttaacccctttggtttctgagggaaatgggttgtggtaatctggagcaataattgtttcagctaggattcaaac |
11630775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11683675 - 11683588
Alignment:
| Q |
20 |
tttttcttgtactttttgtatggttttagcaacttgtgtcatgtgatct--ctagttgttttgacatgctttgctgtttttattaata |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| | ||||||| | || |||||||||||| |||||||||||||||||||| |
|
|
| T |
11683675 |
tttttcttgtacttttcgtatggttttagcaacttgtttaatgtgattttcgtatttgttttgacattctttgctgtttttattaata |
11683588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University