View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_80 (Length: 258)
Name: NF11854_high_80
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_80 |
 |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 40544076 - 40544312
Alignment:
| Q |
7 |
gaaggacagggcagatgcacatgatgttgttaataccaacttgtgcaacacctctttgtttcaattctattccaaacgtgagttcaatcttgacataatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
40544076 |
gaaggacagggcagatgcacatgatgctgttaataccaacttgtgcaactcctccttgtttcaattctattccaaacgtgtgttaaatcttgacataatc |
40544175 |
T |
 |
| Q |
107 |
gagaccacttatagtcgaactgagcttgcattcgtagccaatttgatccgtaactggatagatataaagactgtggattctcttattttcgttgtcatgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40544176 |
gagaccacttatagtcgaactgagcttgcatccgtagccaatttgatccgtaactggatagatataaagactgtggattctcttattttcgttgtcatgg |
40544275 |
T |
 |
| Q |
207 |
accgtgtgtggaaggcattgcaagcaaggttgttagt |
243 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
40544276 |
accgtgtgcggaagtcattgcaagcaaggttattagt |
40544312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 108 - 243
Target Start/End: Complemental strand, 20807 - 20673
Alignment:
| Q |
108 |
agaccacttatagtcgaactgagcttgcattcgtagccaatttgatccgtaactggatagatataaagactgtggattctcttattttcgttgtcatgga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||| |||||| |||||||||||||||||| | |||||||||||| ||||||| ||||||||| |
|
|
| T |
20807 |
agaccacttatagtcgaactgagcttgcagccgttgccaatatgatccctaactggatagatataaa-attgtggattctctcattttcgctgtcatgga |
20709 |
T |
 |
| Q |
208 |
ccgtgtgtggaaggcattgcaagcaaggttgttagt |
243 |
Q |
| |
|
||||||| |||| | |||||||||||||||||||| |
|
|
| T |
20708 |
ccgtgtgcggaaaactttgcaagcaaggttgttagt |
20673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 96 - 212
Target Start/End: Complemental strand, 35407533 - 35407417
Alignment:
| Q |
96 |
ttgacataatcgagaccacttatagtcgaactgagcttgcattcgtagccaatttgatccgtaactggatagatataaagactgtggattctcttatttt |
195 |
Q |
| |
|
||||||| || |||||||||| |||||||| | ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| | || |
|
|
| T |
35407533 |
ttgacattattgagaccacttgtagtcgaaacgtgcttgcagcagtagccaatttgatccgtaactggatagataaaaagactgtggattctcttttctt |
35407434 |
T |
 |
| Q |
196 |
cgttgtcatggaccgtg |
212 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
35407433 |
cgttgtcatggatcgtg |
35407417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University