View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_81 (Length: 257)
Name: NF11854_high_81
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 7 - 142
Target Start/End: Original strand, 30929927 - 30930062
Alignment:
| Q |
7 |
gaagcagagaccttcctagctagttgtaatgcccacaagaatgaaagatgattggagtgtatcaaattggattctctcttttcaatcattttcattctct |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30929927 |
gaagcaaagaccttcctagctagttgtaatgcccacaagaatgaaagatgattggagtgtatcaaattggattctctcttttcaatcattttcattctct |
30930026 |
T |
 |
| Q |
107 |
ccccttccacgattttgtgtctgtctatctatctat |
142 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30930027 |
ccccttccacgattttgtgtctgtctgtctatctat |
30930062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 139 - 240
Target Start/End: Original strand, 30931012 - 30931112
Alignment:
| Q |
139 |
ctattgatattctctctaaaatttagagatatgcacaaattgtagaaggcgagagtgagtggaaggagatgatcaaatttctctattagaatgactcgaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||| | |||| ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
30931012 |
ctattgatattctctctaaaatttagagataggcacaaattgtaaaaggagggagtaagtggaa-gagatgatcaaatccctctattagaatgactcgaa |
30931110 |
T |
 |
| Q |
239 |
tc |
240 |
Q |
| |
|
|| |
|
|
| T |
30931111 |
tc |
30931112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 15942089 - 15942133
Alignment:
| Q |
137 |
atctattgatattctctctaaaatttagagatatgcacaaattgt |
181 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
15942089 |
atctcttgatcttctctctaaaatttagagatagacacaaattgt |
15942133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University