View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_high_84 (Length: 250)
Name: NF11854_high_84
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_high_84 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 40544031 - 40543962
Alignment:
| Q |
1 |
gtagagtgcagctttaccattgacatcttggaagcacaagttacccaaaagggacattgtaaaggcactt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40544031 |
gtagagtgcagctttaccattgacatcttggaagcacaaattacccaaaagggatattgtaaaggcactt |
40543962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 234
Target Start/End: Complemental strand, 40543832 - 40543798
Alignment:
| Q |
200 |
tagttaaccaactttgaaacattcacccttgaggg |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40543832 |
tagttaaccaaatttgaaacattcacccttgaggg |
40543798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University