View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_low_104 (Length: 234)
Name: NF11854_low_104
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_low_104 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 47469720 - 47469505
Alignment:
| Q |
19 |
agcataacaaaaatgatgtaacataaacattttaacaattctcaggcactaaaggacataccacgagatcaaattcagattgctacaaagtttgggattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469720 |
agcataacaaaaatgatgtaacataaacattttaacaattctcaggcacttaaggacataccacgagatcaaattcagattgctacaaagtttgggattg |
47469621 |
T |
|
| Q |
119 |
tcaaaatggaatctggtaacgttgtagtaaatggtagtcctgaatatgttcgatcatgttgtgagggtagtcttcaacgtcttggggtggattacattga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469620 |
tcaaaatggaatctggtaacgttgtagtaaatggtagtcctgaatatgttcgatcatgttgtgagggtagtcttcaacgtcttggggtggattacattga |
47469521 |
T |
|
| Q |
219 |
tctctattatcagcac |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47469520 |
tctctattatcagcac |
47469505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University