View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11854_low_19 (Length: 606)

Name: NF11854_low_19
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11854_low_19
NF11854_low_19
[»] chr6 (4 HSPs)
chr6 (508-596)||(25517219-25517305)
chr6 (508-550)||(25525487-25525529)
chr6 (508-550)||(26086218-26086260)
chr6 (508-549)||(26069107-26069148)
[»] chr7 (1 HSPs)
chr7 (56-95)||(46430760-46430799)
[»] chr4 (2 HSPs)
chr4 (508-550)||(9601333-9601375)
chr4 (508-542)||(9604744-9604778)
[»] chr3 (1 HSPs)
chr3 (57-118)||(1374119-1374180)


Alignment Details
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 508 - 596
Target Start/End: Complemental strand, 25517305 - 25517219
Alignment:
508 ggttttctgtttttcttgattttgacatgtttccaattgtttttggcttcnnnnnnnnngtttaaagaagcattgtcattttccctttg 596  Q
    ||||||||||||| |||||||||||||||||||  |||||||||||||||         ||||||||||||||||||||||||||||||    
25517305 ggttttctgttttgcttgattttgacatgtttcttattgtttttggcttc--aaaaaaagtttaaagaagcattgtcattttccctttg 25517219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 25525529 - 25525487
Alignment:
508 ggttttctgtttttcttgattttgacatgtttccaattgtttt 550  Q
    ||||||||||||| ||||||||| | |||||||||||||||||    
25525529 ggttttctgttttgcttgatttttaaatgtttccaattgtttt 25525487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 26086260 - 26086218
Alignment:
508 ggttttctgtttttcttgattttgacatgtttccaattgtttt 550  Q
    ||||||||||||| ||||||||| | |||||||||||||||||    
26086260 ggttttctgttttgcttgattttaaaatgtttccaattgtttt 26086218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 508 - 549
Target Start/End: Complemental strand, 26069148 - 26069107
Alignment:
508 ggttttctgtttttcttgattttgacatgtttccaattgttt 549  Q
    ||||||||||||| ||||||||| | ||||||||||||||||    
26069148 ggttttctgttttgcttgattttaaaatgtttccaattgttt 26069107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 46430799 - 46430760
Alignment:
56 ctgtgacaacagttcaaccattaagctgtcaaaaaatcct 95  Q
    |||||||||||||||| |||||||||||||||| ||||||    
46430799 ctgtgacaacagttcatccattaagctgtcaaagaatcct 46430760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 550
Target Start/End: Complemental strand, 9601375 - 9601333
Alignment:
508 ggttttctgtttttcttgattttgacatgtttccaattgtttt 550  Q
    ||||||||||||| ||||||||| | |||||||||||||||||    
9601375 ggttttctgttttacttgattttaaaatgtttccaattgtttt 9601333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 508 - 542
Target Start/End: Complemental strand, 9604778 - 9604744
Alignment:
508 ggttttctgtttttcttgattttgacatgtttcca 542  Q
    ||||||||||||||||||||||||| |||||||||    
9604778 ggttttctgtttttcttgattttgaaatgtttcca 9604744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 118
Target Start/End: Original strand, 1374119 - 1374180
Alignment:
57 tgtgacaacagttcaaccattaagctgtcaaaaaatcctgtcctccacggaagaagcaaaca 118  Q
    ||||| |||||||| || |||||| |||| |||||||||||  | |||||||||||||||||    
1374119 tgtgataacagttccacaattaagttgtccaaaaatcctgttatgcacggaagaagcaaaca 1374180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University