View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_low_36 (Length: 401)
Name: NF11854_low_36
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 4394106 - 4393741
Alignment:
| Q |
18 |
caaacagatgttcagatgtggggggatttggtgcattattttcacggacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394106 |
caaacagatgttcagatgtggggggatttggtgcattattttcacagacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatg |
4394007 |
T |
 |
| Q |
118 |
atctcactaagcaggaaactggtagtgcaattaccagtgttatggtgttgctgaccatgtgattgagcaggaaccatgttggaaagttcagagaagcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394006 |
atctcactaagcaggaaactggtagtgcaattaccagtgttatggtgttgctgaccatgtgattgagcaggaaccatgttggaaagttcagagaagcaaa |
4393907 |
T |
 |
| Q |
218 |
acccttgtgatgtaacattgttaggaagcactattccttgtccatgatgttgcaccgggaagaagaaagtctcggtagttggtgcagttacttgtggtgg |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4393906 |
acccttgtgatgtaacattattaggaagcactattccttgtccatgatgttgcaccgggaagaagaaagtctcagtagttggtgcagttacttgtggtgg |
4393807 |
T |
 |
| Q |
318 |
tggaagaagggtagtaacattttgagtctgaaaatatgtttggttttgattcacagaagcagttgg |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4393806 |
tggaagaagggtagtaacattttgagtctgaaaatatgtttggttttgattcacagaagcagttgg |
4393741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University