View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_low_56 (Length: 315)
Name: NF11854_low_56
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 2 - 297
Target Start/End: Original strand, 40998049 - 40998346
Alignment:
| Q |
2 |
catttacaaaattcggtccaacttacttaactagctcaatcctggatttttactggtttaaacgattttagtttggttttt-ctca-gttcttttgttac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40998049 |
catttacaaaattcggtccaacttacttaactagctcaatcgtggattttgactggtttaaacgattttagtttggttttttctcaagttcttttgttac |
40998148 |
T |
 |
| Q |
100 |
cttgctatcgtctatttatgtagaaaaagttacttttattacctctatagttttaacaattctactaaatgcatagacatatcatcacttagattgatca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40998149 |
cttgctatcgtctatttatgtagaaaaagttatttttattacctctatagttttaacaattctactaaatgcatagacagatcatcacttagattgatca |
40998248 |
T |
 |
| Q |
200 |
attcgatcttattttcattaccttgctattgtctatttatcgtgattcaaacacaccatggcaaacaactctcttcccccactctcaaccctcgccgt |
297 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998249 |
attcgatcttatttttattaccttgctattgtctatttatcgtgattcaaacacaccatggcaaacaactctcttcccccactctcaaccctcgccgt |
40998346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University