View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11854_low_80 (Length: 263)

Name: NF11854_low_80
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11854_low_80
NF11854_low_80
[»] chr3 (1 HSPs)
chr3 (33-254)||(49852254-49852475)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 49852254 - 49852475
Alignment:
33 ctttggctctgctgctactatgatggtagactttcagaattagacatttatctccagattggcggtgccttctccagtgaaattgattttttcacaacct 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49852254 ctttggctctgctgctactatgatggtagactttcagaattagacatttatctccagattggcggtgccttctccagtgaaattgattttttcacaacct 49852353  T
133 ttttctctactaccgaatcttcagacccttctttttctccttctctaccgaaaacttcaagttttccttcttttgatcttgacctacctttcaccacgtc 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49852354 ttttctctactaccgaatcttcagacccttctttttctccttctctaccgaaaacttcaagttttccttcttttgatcttgacctacctttcaccacgtc 49852453  T
233 ccgaattcaacaatccctatgc 254  Q
    ||||||||||||||||||||||    
49852454 ccgaattcaacaatccctatgc 49852475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University