View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11854_low_91 (Length: 248)
Name: NF11854_low_91
Description: NF11854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11854_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 54 - 229
Target Start/End: Original strand, 52911156 - 52911342
Alignment:
| Q |
54 |
taaatttggtggtacccatataagtttcaaccatttggtacaagtgtgttagaaagattgtttgttgcagcgttcnnnnnnnatttcctgtttggccctt |
153 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
52911156 |
taaattttgtggtacccatataagtttcaaccatttggtacaagtgtgttagaaagattgtttgttgcagtgttctttttttatttcctgtttggccctt |
52911255 |
T |
|
| Q |
154 |
tctctcttcactggaaaagataaaa-----------gagactatcagtatgaaattattaatctttcttacaatcacctgcaaacca |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52911256 |
cctctcttcactggaaaagataaaaaaattgttcacaagactatcagtatgaaattattaatctttcttacaatcacctgcagacca |
52911342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 52911121 - 52911166
Alignment:
| Q |
1 |
tttctcctattggttgaaactcaaataggtctcactaaattttgtg |
46 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52911121 |
tttctcctattgtttgaaactcaaataggtctcactaaattttgtg |
52911166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University