View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11855_high_11 (Length: 460)
Name: NF11855_high_11
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11855_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 204 - 445
Target Start/End: Complemental strand, 54504851 - 54504610
Alignment:
| Q |
204 |
acgtctccgaggatgaggaattggagtggatgaccagggcgtgggtggtgaaggtggcggaggaggggaagaaattatgggagctgccataacaacaaca |
303 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
54504851 |
acgtctcggaggatgaggaattggagttgatgaccgaggcgtgggtggtgaaggcggcggaggaggggaagaaagtacgggagctaccataacaacaaca |
54504752 |
T |
 |
| Q |
304 |
gctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54504751 |
gctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggt |
54504652 |
T |
 |
| Q |
404 |
ctacatgctctcctcttattctacatctatcatagtcttcct |
445 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54504651 |
ctacatgctctcctcttattccacatctatcatagtcttcct |
54504610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 54505030 - 54504918
Alignment:
| Q |
34 |
ggtgacggtgccagtgatggtgactctgagggtactgaaggcgactttgacagtgatggtgatggtga------aactggtgaacgtttccgaggatgag |
127 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
54505030 |
ggtgacggtgccagtgatggtgactcggagggt---gaaggcgactttgacagtgatggtgatggtgatggtgaagctggtgaacgtttccgaggatgag |
54504934 |
T |
 |
| Q |
128 |
gaattggagttgaccg |
143 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54504933 |
gaattggagttgaccg |
54504918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 295 - 416
Target Start/End: Complemental strand, 54496660 - 54496539
Alignment:
| Q |
295 |
acaacaacagctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgt |
394 |
Q |
| |
|
||||| ||||| |||||||| |||| | |||||||||||||| |||||||||||||||||| || |||| |||| | |||||| ||| | || ||||||| |
|
|
| T |
54496660 |
acaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatactcctattttatcaagcacaaccttagtgttgccgt |
54496561 |
T |
 |
| Q |
395 |
cgtagtggtctacatgctctcc |
416 |
Q |
| |
|
||| ||| || ||||| ||||| |
|
|
| T |
54496560 |
cgtggtgctccacatgttctcc |
54496539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University