View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11855_high_20 (Length: 318)
Name: NF11855_high_20
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11855_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 304
Target Start/End: Complemental strand, 33529014 - 33528721
Alignment:
| Q |
11 |
gacatcaagcacagcacatggagttatagctgtgaattcatgaatgttgcctccagttgttggatacaatactgaagtatcacatggtgctgtgaacact |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33529014 |
gacatcaagcacagcacatggagttatagctgtgaattcatgaatgttgcctccagttgttggatacaatactgaagtatcacatggtgctgtgaacgtt |
33528915 |
T |
|
| Q |
111 |
ttatttgcttttaactttgccaatctcactgcaaatagaaaattaaccatgttagtcacattttaaaaaccaacacagggttaggacctagattgtctgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33528914 |
ttatttgcttttaactttgccaatctcactgcaaatagaaaattaaccatgttagtcacattttaaaaaccaacacagggttaggacctagattgtctac |
33528815 |
T |
|
| Q |
211 |
atttgaaaatccgtgcagtcacatggttagtcaaatcaatactatttatgtgattgcgcggattgacagcaacagacaacataggtcttcatga |
304 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
33528814 |
atttgacaatccatgcagtcacatggttagtcaaatcaatactatttatgtgattgcgcggattgacagcaacagacaacttaggtctccatga |
33528721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 11 - 145
Target Start/End: Original strand, 9691070 - 9691204
Alignment:
| Q |
11 |
gacatcaagcacagcacatggagttatagctgtgaattcatgaatgttgcctccagttgttggatacaatactgaagtatcacatggtgctgtgaacact |
110 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| || |||||||||||| |||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
9691070 |
gacatcaagaacagcacatggagttatggctgtgaattcatggatattgcctccagtttttggatacaacactgaagtgtcacatggtgatgtgaacact |
9691169 |
T |
|
| Q |
111 |
ttatttgcttttaactttgccaatctcactgcaaa |
145 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9691170 |
ttatttgcttttaactttgccaacctcactgcaaa |
9691204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University