View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11855_high_24 (Length: 309)
Name: NF11855_high_24
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11855_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 144 - 302
Target Start/End: Original strand, 34752303 - 34752476
Alignment:
| Q |
144 |
attatataatgataatattcttttttgagtttccgttttggatgtctcacccttaaccactcacattaaaccttagttatgagtcaattatgattctatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34752303 |
attatataatgataatattcttttttgagtttccgttttggatgtctcacccttaaccactcacattaaaccttatttatgagtcaattatgattctatt |
34752402 |
T |
 |
| Q |
244 |
aggtctgt---------------tatcagttagtacgttgcttttttcattggaatttgatctttcctatgctt |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34752403 |
aggtctgttagagttagttattctatcagttagtacgttgcttttttcattggaatttgatctttcttatgctt |
34752476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 34751830 - 34751919
Alignment:
| Q |
18 |
gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccatttcaaccatgtttgactgcaatgtcttgatctagtttata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34751830 |
gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccatttcaaccatgtttgactgcaatgtcttgatctagtttata |
34751919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 34742363 - 34742412
Alignment:
| Q |
18 |
gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccat |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
34742363 |
gtttacttacaacatagcaactagggaatggttgaaggttcctgtgccat |
34742412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University