View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11855_high_29 (Length: 236)

Name: NF11855_high_29
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11855_high_29
NF11855_high_29
[»] chr7 (1 HSPs)
chr7 (83-231)||(40433679-40433827)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 83 - 231
Target Start/End: Complemental strand, 40433827 - 40433679
Alignment:
83 ctgctagccgtgaagaattaggagatcacatacattgattaagtgatgattgcatgctaacatagattgatagaatattgtttgaatgttaattgattga 182  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40433827 ctgctagccgtgaagaatcaggagatcacatacattgattaagtgatgattgcatgctaacatagattgatagaatattgtttgaatgttaattgattga 40433728  T
183 gttatgaatttgacgaacttatctactctactagcgcaataaaattgca 231  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||    
40433727 gttatgaatttgacgaacttatctactctactagctcaataaaattgca 40433679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University