View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11855_high_29 (Length: 236)
Name: NF11855_high_29
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11855_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 83 - 231
Target Start/End: Complemental strand, 40433827 - 40433679
Alignment:
| Q |
83 |
ctgctagccgtgaagaattaggagatcacatacattgattaagtgatgattgcatgctaacatagattgatagaatattgtttgaatgttaattgattga |
182 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40433827 |
ctgctagccgtgaagaatcaggagatcacatacattgattaagtgatgattgcatgctaacatagattgatagaatattgtttgaatgttaattgattga |
40433728 |
T |
|
| Q |
183 |
gttatgaatttgacgaacttatctactctactagcgcaataaaattgca |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40433727 |
gttatgaatttgacgaacttatctactctactagctcaataaaattgca |
40433679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University