View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11855_low_26 (Length: 309)

Name: NF11855_low_26
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11855_low_26
NF11855_low_26
[»] chr8 (3 HSPs)
chr8 (144-302)||(34752303-34752476)
chr8 (18-107)||(34751830-34751919)
chr8 (18-67)||(34742363-34742412)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 144 - 302
Target Start/End: Original strand, 34752303 - 34752476
Alignment:
144 attatataatgataatattcttttttgagtttccgttttggatgtctcacccttaaccactcacattaaaccttagttatgagtcaattatgattctatt 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
34752303 attatataatgataatattcttttttgagtttccgttttggatgtctcacccttaaccactcacattaaaccttatttatgagtcaattatgattctatt 34752402  T
244 aggtctgt---------------tatcagttagtacgttgcttttttcattggaatttgatctttcctatgctt 302  Q
    ||||||||               ||||||||||||||||||||||||||||||||||||||||||| |||||||    
34752403 aggtctgttagagttagttattctatcagttagtacgttgcttttttcattggaatttgatctttcttatgctt 34752476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 34751830 - 34751919
Alignment:
18 gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccatttcaaccatgtttgactgcaatgtcttgatctagtttata 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34751830 gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccatttcaaccatgtttgactgcaatgtcttgatctagtttata 34751919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 34742363 - 34742412
Alignment:
18 gtttacttacaacatagcaactagggaatggctgaaggtttttgtgccat 67  Q
    ||||||||||||||||||||||||||||||| ||||||||  ||||||||    
34742363 gtttacttacaacatagcaactagggaatggttgaaggttcctgtgccat 34742412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University