View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11855_low_32 (Length: 227)
Name: NF11855_low_32
Description: NF11855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11855_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 204
Target Start/End: Original strand, 26491764 - 26491947
Alignment:
| Q |
21 |
aaggtctgatattttagcagcataatcttcagtgaggtatatagaagaagataacagatttctgtgggaaatgggtggtgtgagttgatgcatgtggtct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
26491764 |
aaggtctgatattttagcagcataatcttcagttaggtatatagaagaagataacagatttctgtgggaaatgggtggtgtgagattatgcatgtggtct |
26491863 |
T |
|
| Q |
121 |
agacagtaagctattcccatagctatcctctttctcattccccagtctagttcttctgcttctctaactgcaatacatacatga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
26491864 |
agacagtaagctattcccatagctatcctctttctcattccccagtctagctcttctgcttctctaactgcaatatatacatga |
26491947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University