View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_36 (Length: 372)
Name: NF11856_high_36
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 363
Target Start/End: Complemental strand, 7067351 - 7067005
Alignment:
| Q |
17 |
cttcttattcttccattattcagttgaagacacaccaaaaccaaagaaccttggattgttcaacttcaaattctatgtcccaagattatcagcaagcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067351 |
cttcttattcttccattattcagttgaagacacaccaaaaccaaagaaccttggattgttcaacttcaaattctatgtcccaagattatcagcaagcaat |
7067252 |
T |
|
| Q |
117 |
cttcggcttctcctcgaatggattcgagagatcatcatcgtcannnnnnnnnnnnnnnnnnnnnnnacagatccaaagggacaaagttaggctgcttcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7067251 |
cttcggcttctcctcgaatggattcgagagatcatcgtcgtcacaacagcagcaacagcagcagcaacagatccaaagggacaaagttaggctgcttcaa |
7067152 |
T |
|
| Q |
217 |
gggttgaatttatcagaaggagaaggagatgaaagaggaggtgtgtatgaaactgcaggtatgttatcagagatgtttaattttgctgatccttcaacag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067151 |
gggttgaatttatcagaaggagaaggagatgaaagaggaggtgtgtatgaaactgcaggtatgttatcagagatgtttaattttgctgatccttcaacag |
7067052 |
T |
|
| Q |
317 |
ctgaattgttagaaaccgcgacgtttcgttcttcgtcttcttcttct |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067051 |
ctgaattgttagaaaccgcgacgtttcgttcttcgtcttcttcttct |
7067005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University