View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_56 (Length: 294)
Name: NF11856_high_56
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_56 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 16635357 - 16635122
Alignment:
| Q |
18 |
gatcaagacgtccggactaacaatttcaatattgttgccggttgaactaggatttatgggactgtttttccatttttctattgcgcttatttgtgtgttt |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| || | |||||| ||||||||||| |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
16635357 |
gatcaagacgtccggcctaacaatttcaatatttttactggttgagttaggatttatgtgactgtttttccgtttttctattgcgcttacttgtgtgttt |
16635258 |
T |
|
| Q |
118 |
attttataagtattttgttacaaaaaatgtgagtttgtaggggatttttgactgtttctaggggcttttggccgttggtaaaaccctatattttgatgaa |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16635257 |
attttacaagtattttgttacaaaaaatgtgagtttgtaggggatttttgactgtttctaggggcttttggccgttggtaataccctatattttgatgaa |
16635158 |
T |
|
| Q |
218 |
agtggtttcattagtaacaaccattcgcacccattc |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16635157 |
agtggtctcattagtaacaaccattcgcacccattc |
16635122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 19384 - 19440
Alignment:
| Q |
19 |
atcaagacgtccggactaacaatttcaatattgttgccggttgaactaggatttatg |
75 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||| ||||| |||||||||||| ||||| |
|
|
| T |
19384 |
atcatgacgtccggcctaacaatttcaacatttttgccagttgaactaggacttatg |
19440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 21422028 - 21421964
Alignment:
| Q |
24 |
gacgtccggactaacaatttcaatattgttgccggttgaactaggatttatgggactgtttttcc |
88 |
Q |
| |
|
|||||||| ||||||||||| ||||| || || |||||||||||||||||||||| ||||||| |
|
|
| T |
21422028 |
gacgtccgatctaacaatttcgatatttttaccagttgaactaggatttatgggacaatttttcc |
21421964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University