View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_64 (Length: 274)
Name: NF11856_high_64
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 80 - 257
Target Start/End: Original strand, 52874332 - 52874509
Alignment:
| Q |
80 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttaaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874332 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttgaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
52874431 |
T |
|
| Q |
180 |
aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagactt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874432 |
aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagactt |
52874509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University