View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_70 (Length: 249)
Name: NF11856_high_70
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 1133381 - 1133628
Alignment:
| Q |
1 |
atgttgttagttttatgattaattgcacatttcagttt--ctctctaacagttaaatttctttgatagggttgtaatctttgtttgcttttacaagacac |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1133381 |
atgttgttagttttatgatttattgcacatttcagtttttctctctaacagttaaatttctttgatagggttgtaatctttgtttgcttttacaagacac |
1133480 |
T |
 |
| Q |
99 |
atggaggataaaatgtcactgtataaatgaattgcaacaaattaagatgtgattatgtaaaattattatgaaataaagacaacatggttatcatgtaatt |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1133481 |
atggaggataaaatgtcactgcataaatgaattgcaacaaattaagatgtgattatgtaaaattattatgaaataaagacaacatggttatcatgtaatt |
1133580 |
T |
 |
| Q |
199 |
atatgcatacaattataagcatacatgtatcttttcaatacaattctt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1133581 |
atatgcatacaattataagcatacatgtatcttttcaatacaattctt |
1133628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University