View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_86 (Length: 229)
Name: NF11856_high_86
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_86 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 7 - 176
Target Start/End: Original strand, 36652717 - 36652897
Alignment:
| Q |
7 |
tatgaaggagaaaacaaagtagtgttaccttgttcttacagatgttatttttcacatctaactctacgatgtgggactattctgcagttttgga------ |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36652717 |
tatgaaggagaaaacaaagtagtgttaccttgttcttacagatgttatttttcgcatctaactctacgatgtgggacaattctgcagttttggaacacca |
36652816 |
T |
|
| Q |
101 |
-----ggttattcatttctacatatatttcgtatctaactatacttactaacattgttgcaataatattaccgtgaaaaag |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36652817 |
tatttggttattcatttctacatatatttcgtatctaactatacttactaacattgttgcaataatattaccgtgacaaag |
36652897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 3270896 - 3270860
Alignment:
| Q |
177 |
tgttagaaggctagaacaacattgctggaaataaaag |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
3270896 |
tgttagagggctagaacaacattgctggaaattaaag |
3270860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 208
Target Start/End: Original strand, 3222855 - 3222887
Alignment:
| Q |
176 |
gtgttagaaggctagaacaacattgctggaaat |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
3222855 |
gtgttagagggctagaacaacattgctggaaat |
3222887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University