View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11856_high_90 (Length: 212)

Name: NF11856_high_90
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11856_high_90
NF11856_high_90
[»] chr2 (2 HSPs)
chr2 (131-190)||(18126174-18126233)
chr2 (19-66)||(18126062-18126109)


Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 18126174 - 18126233
Alignment:
131 atgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18126174 atgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt 18126233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 18126062 - 18126109
Alignment:
19 aagggacccaaagattctcttttggaagttaacttctccatgtttatc 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
18126062 aagggacccaaagattctcttttggaagttaacttctccatgtttatc 18126109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University