View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_high_90 (Length: 212)
Name: NF11856_high_90
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_high_90 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 18126174 - 18126233
Alignment:
| Q |
131 |
atgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126174 |
atgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt |
18126233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 18126062 - 18126109
Alignment:
| Q |
19 |
aagggacccaaagattctcttttggaagttaacttctccatgtttatc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126062 |
aagggacccaaagattctcttttggaagttaacttctccatgtttatc |
18126109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University