View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_39 (Length: 360)
Name: NF11856_low_39
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 19 - 348
Target Start/End: Complemental strand, 14582615 - 14582286
Alignment:
| Q |
19 |
gctataacaaaagcttctgatcctttggagaaaaatgcttaattatttgcttctgctactcagaaaaaagcataatccctttgtgatatgagaagccaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582615 |
gctataacaaaagcttctgatcctttggagaaaaatgcttaattatttgcttctgctactcagaaaaaagcataatccctttgtgatatgagaagccaaa |
14582516 |
T |
 |
| Q |
119 |
agctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggtttttgtttaataccctctcacacttctctccatgtttgttttaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582515 |
agctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggtttttgtttaataccctctcacacttctctccatgtttgttttaagaa |
14582416 |
T |
 |
| Q |
219 |
ccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaagggctccacat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582415 |
ccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaagggctccacat |
14582316 |
T |
 |
| Q |
319 |
agaaaggtagtggggaagttggtgtctctg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14582315 |
agaaaggtagtggggaagttggtgtctctg |
14582286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University