View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_60 (Length: 287)
Name: NF11856_low_60
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 1553331 - 1553064
Alignment:
| Q |
1 |
acaataagtcttttaggactaccagctgcaacaccaactttggctccaatagcagtagtagctaacaaggtttggcttctctttcctccagataagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553331 |
acaataagtcttttaggactaccagctgcaacaccaactttggctccaatagcagtagtagctaacaaggtttggcttctctttcctccagataagaagg |
1553232 |
T |
 |
| Q |
101 |
aagatcccaaaccattcaacacagcaccagatgttgcagctgccatttgtcttctagagataaagagtaatgagactggttttgtagttcacttgggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553231 |
aagatcccaaaccattcaacacagcaccagatgttgcagctgccatttgtcttctagagataaagagtaatgagactggttttgtagttcacttgggaat |
1553132 |
T |
 |
| Q |
201 |
tgaactgaactagttagagagtattttatgagtgtgtgtgagaatctgaaggggttttcatagaaggc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1553131 |
tgaactgaactagttagagagtattttatgagtgtgtgagagaatctgaaggggttttcatagaaggc |
1553064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University