View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_61 (Length: 286)
Name: NF11856_low_61
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_61 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0790 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 897 - 1151
Alignment:
| Q |
16 |
ttaggtgtttttaagcaccaggtatagtctaaagttatgaaatgaaccgtttttgtgcaaatgttttgttcttttgcggaaaagaaacttgatatttgtt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
897 |
ttaggtgtttttaagcacggggtatagtctaaagttatgaaatgaatcgtttta-tgcaaatgttttgttcttttgcggaaaagaaacttaat---tgtt |
992 |
T |
 |
| Q |
116 |
ttaactctttgttcccctgaaccctaattaaataaaaaggaagaaaa---ggtaatttttgttgtgaggatggaaaccacgttgtgattcataggtttat |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
993 |
ttaactctttgttcccctgaaccataattaaataaaaaggaagaaaataaggtaaattttgttgtgagaatggaaaccacgttgtgattcataggtttat |
1092 |
T |
 |
| Q |
213 |
cgaaactttaagttaaacctccgtgtcattctgaattttcctatatatcgatccgttac |
271 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| |||| |||| ||||| |
|
|
| T |
1093 |
cgaaactttcagttaaacctccgtatcattctgaattttcctagatattgatctgttac |
1151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University