View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_64 (Length: 276)
Name: NF11856_low_64
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_64 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 276
Target Start/End: Original strand, 14582040 - 14582309
Alignment:
| Q |
7 |
atgagatggacatcaaaaaaggttaggccattaggttgagattaagattgaattaatcaaacaaacatctttatccattataattattttaatggacaca |
106 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582040 |
atgagattgatatcaaaaaaggttaggccattaggttgagattaagattgaattaatcaaacaaacatctttatccattataattattttaatggacaca |
14582139 |
T |
 |
| Q |
107 |
cagtagtactattttcttttatgtgagtgcttatacattgcaacttttgatggtgttaaatagtcattttagataatgaaaaagaatgatacacacacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582140 |
cagtagtactattttcttttatgtgagtgcttatacattgcaacttttgatggtgttaaatagtcattttagataatgaaaaagaatgatacacacacca |
14582239 |
T |
 |
| Q |
207 |
ctttcatatatacttctcaaccatcacaagtatttaaaacaatgatcagagacaccaacttccccactac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582240 |
ctttcatatatacttctcaaccatcacaagtatttaaaacaatgatcagagacaccaacttccccactac |
14582309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University