View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_68 (Length: 261)
Name: NF11856_low_68
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 44551741 - 44551508
Alignment:
| Q |
9 |
ttggagtatatggatgaagttgcaattcaaaagtttagggtgataaggatgaatcgacacaagttactattgacacatgaggagttcctgcaagattggt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44551741 |
ttggtgtatatggatgaagttgcaattcaaaagtttagggtgataaggatgaatcgacacaagttactattgacacatgaggagttcctgcaagattggt |
44551642 |
T |
|
| Q |
109 |
taaaatgtcaagattgtatcagcgctaagaattttattggaaagattgaatgcggggtatatttgaaagaaaccaccttaaaattatgttagatacgatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44551641 |
taaaatgtcaagattgtatcagcgctaagaattttattggaaagattgaatgcggggtatatttgaaagaaaccaccttaaaattatgttagatacaatg |
44551542 |
T |
|
| Q |
209 |
ttgatgcctcgttttctcaattgcataataaggg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44551541 |
ttgatgcctcgttttctcaattgcataataaggg |
44551508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University