View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_73 (Length: 249)
Name: NF11856_low_73
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_73 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 1574970 - 1574735
Alignment:
| Q |
14 |
agggaaatgggcgtataaaagcagagttcaaatgccaaatcttgatggagactttgatgtttatgttagttgcattgttaaatagaaataattttgcagc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1574970 |
agggaaatgggcgtataaaagcagagttcaaatgccaaatcttgagggagactttgatgtttatgttagttgcattgttaaatagaaataattttgcagc |
1574871 |
T |
|
| Q |
114 |
tccatatattgcttctgttggataaactctacctgagatcacaactcttcctccttgagcaaagctctcaataattgaatggtcaacctgataacgttga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1574870 |
tccatatattgcttctgttggataaactctacctgagatcacaactcttcctccttgagcaaagctctcaataattgaatggtcaacctgataacattga |
1574771 |
T |
|
| Q |
214 |
atcaaaccgatttaaattagtttgagtctcgattcc |
249 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1574770 |
atcgaaccgatttaaattagtttgagtctcgattcc |
1574735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University