View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_76 (Length: 244)
Name: NF11856_low_76
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 133 - 235
Target Start/End: Original strand, 3247575 - 3247677
Alignment:
| Q |
133 |
tcaagatactattgatggcagaactttcaacgcgatactattatatttgattttttaaccggtatctctaaaacactctgtgcaagttcatttaatccct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
3247575 |
tcaagatactattgatggcagaactttcaacaagatactattatatttgattttttaaccaatatctccaaaacactctgtgcaagttcatttaatgcct |
3247674 |
T |
|
| Q |
233 |
ttg |
235 |
Q |
| |
|
||| |
|
|
| T |
3247675 |
ttg |
3247677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 3247073 - 3247187
Alignment:
| Q |
1 |
atactactacactccaatacgtctttgttttgacatcattagatagtga-ttatacaccnnnnnnntcatttagataatgatcccatacacatactagta |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
3247073 |
atactactacactccaataagtctttgttttgacatcattagatagtgatttatacaccaaaaaaattatttagataatgatcccatacacatactagta |
3247172 |
T |
|
| Q |
100 |
ccggtagtagtacat |
114 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3247173 |
ccggtagtagtacat |
3247187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University