View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_80 (Length: 239)
Name: NF11856_low_80
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_80 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 32942784 - 32943010
Alignment:
| Q |
1 |
ttgaataatttcagtttttggtgatcatcaaatagtgattattgttgattatatgtcaacatagctacatctagtaattacagtgcatataaacagttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942784 |
ttgaataatttcagtttttggtgatcatcaaatagtgattattgttgattatatgtcaacatagctacatctagtaattacagtgcatataaacagttaa |
32942883 |
T |
|
| Q |
101 |
acagctagcacaggctttgccggatatgcatgcagaaattaagagatgtcaaatctttattattcgatgttgaaagtatagggt--tatatatgcaatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32942884 |
acagctagcacaggctttgccggatatgcatgcagaaattaagagatgtcaaatctttattattcgatgttgaaagtatagggttatatatatgcaatga |
32942983 |
T |
|
| Q |
199 |
ttcatggtgaataacagttcaaatttg |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32942984 |
ttcatggtgaataacagttcaaatttg |
32943010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University