View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_81 (Length: 239)
Name: NF11856_low_81
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 44 - 225
Target Start/End: Complemental strand, 51365171 - 51364990
Alignment:
| Q |
44 |
aaatcaacgaaagttgtaccataggctcgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51365171 |
aaatcaacgaaagttgtaccataggcttgtaaatcaaactcttatgtttgtctcaggtatatccgttttcggtttgacttgttggttgttcataaagttt |
51365072 |
T |
 |
| Q |
144 |
cttttggctttatttgatttttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51365071 |
cttttggctttatttgatttttgtatatcttggttcatgtgttctacttatttggttgcatatttcattttgatattccatg |
51364990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University