View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11856_low_86 (Length: 233)
Name: NF11856_low_86
Description: NF11856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11856_low_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 3707122 - 3706926
Alignment:
| Q |
16 |
gacatcaggatgttttctaagaaatgaccatatattatatacattccaacattttaaagtatgtatgtgtcaaaaacaaaaatttcaatctctcatagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3707122 |
gacatcaggatgttttctaagaaatgaccatatattatatacattccaacattttatagtatgtatgtgtcaaaaacaaaaatttcaatctctcatagtt |
3707023 |
T |
 |
| Q |
116 |
aatcacttatgagaacacctaactccaatgaaactacacctctaagatctttcaaacactcttgtcatgtaatggttttaaattccggctacgatgc |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3707022 |
aatcacttatgagaacacccaactccaatgaaactacacctctaagatctatcaaacactcttgtcatgtaatggttttaaattccggctacgatgc |
3706926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University