View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11857_high_14 (Length: 311)
Name: NF11857_high_14
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11857_high_14 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 218 - 311
Target Start/End: Complemental strand, 5719965 - 5719872
Alignment:
| Q |
218 |
gatagtaaaaaacacattaaataaattaaacaactatacgtgcaagagcagctaatcacagcttgtagccgcaaattgaaaggtgcttgcttgc |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5719965 |
gatagtaaaaaacacattaaaaaaattaaacaactatacgtgcaagagcagctaatcacaggttgtagccgcaaattgaaaggtgcttgcttgc |
5719872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 75 - 151
Target Start/End: Complemental strand, 5720111 - 5720032
Alignment:
| Q |
75 |
ccaagtagaaactgtaatattccacgcata---gtcacacatgataaccgttgaagttttaacttcaaaaccttccattt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5720111 |
ccaagtagaaactgtaatattccacgcatacaagtcacacatgataaccgttgaagttttaacttcaaaaccttccattt |
5720032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University