View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11857_high_18 (Length: 275)
Name: NF11857_high_18
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11857_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 45587714 - 45587965
Alignment:
| Q |
16 |
caattaataaatcatttaaaaaaccgaataa-----cattaactaattaattgctggtatactttgattagggttgggggaaaacggtgataattggggt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587714 |
caattaataaatcatttaaaaaaccgaataacataacattaactaattaatggttggtatactttgattagggttgggggaaaacggtgataattggggt |
45587813 |
T |
 |
| Q |
111 |
ggaaatgcacggttcgccattgactttaaatccttatgacattttgaaaggcaaaaccattacgggatcactatttggaggcttgaaaccaaaatctgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587814 |
ggaaatgcacggttcgccattgactttaaatccttatgacattttaaaaggcaaaaccattacgggatcactatttggaggcttgaaaccaaaatctgat |
45587913 |
T |
 |
| Q |
211 |
ctccccctccttgctcagaagtacttagacaaagtaagtgctctatgtatct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587914 |
ctccccctccttgctcagaagtacttagacaaagtaagtgctctatgtatct |
45587965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University