View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11857_low_13 (Length: 340)
Name: NF11857_low_13
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11857_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 69 - 307
Target Start/End: Complemental strand, 3047924 - 3047675
Alignment:
| Q |
69 |
tttgtggtgttatcgtatgttgtttattgtgacgtttcgt------------tttctacgcattaaaatgtcttccatattttgactggttgtacatgtt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047924 |
tttgtggtgttatcgtatgttgtttattgtgacgtttcttatatttatttttttgctacgcattaaaatgtcttccatattttgactggttgtacatgtt |
3047825 |
T |
 |
| Q |
157 |
gtcctactagtgttacatacattaatgaaattccttcnnnnnnnnnacatgttaggtttatatcccct-gannnnnnnnnnnnnnnacataaatgaattc |
255 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| | ||||||||||| || |
|
|
| T |
3047824 |
gtcctactagtgttatatacattaatgaaattcctt-tttttttttacatgttaggtttatatcccctcaatttttttttctttttacataaatgaactc |
3047726 |
T |
 |
| Q |
256 |
atagatcataaaaataaaatagaaaatcattttaatatttcttttgtaactt |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3047725 |
atagatcataaaaataaaata-aaaatcattttaatatttcttttgtaactt |
3047675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University