View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11857_low_18 (Length: 281)

Name: NF11857_low_18
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11857_low_18
NF11857_low_18
[»] chr5 (2 HSPs)
chr5 (16-155)||(42471411-42471548)
chr5 (145-265)||(42473732-42473852)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 16 - 155
Target Start/End: Original strand, 42471411 - 42471548
Alignment:
16 tttttaagcataaaatttaaaatcataggcatgggagtaaactttttacaagtaaaaacatatgagaaaataagtccacttatcatatgtcggatatgaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
42471411 tttttaagcataaaatttaaaatcataggcatgggagtaaactttttacaagtaaaaacat--gagaaaataagtccacttatcatatgtcggatttgaa 42471508  T
116 gttgactatgttgcgttgtgaacttaacactttcaattag 155  Q
    |||||||||||| |||||||||||||||||||||||||||    
42471509 gttgactatgttacgttgtgaacttaacactttcaattag 42471548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 145 - 265
Target Start/End: Original strand, 42473732 - 42473852
Alignment:
145 ctttcaattagtttac-ggtgatgattgatttagggttgtgagcaaatttgaggttttatgtttttattacattattaatgaaatatgtaaataacaatt 243  Q
    |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
42473732 ctttcaattagtttaccggtgatgattgattttgggttgtgagcaaatttgaggttttatgtttt-attacattattaatgaaatatgtaaataacaatt 42473830  T
244 ctttttcgaaaacttacaatgg 265  Q
     |||||||||||||||||||||    
42473831 ttttttcgaaaacttacaatgg 42473852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University