View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11857_low_18 (Length: 281)
Name: NF11857_low_18
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11857_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 16 - 155
Target Start/End: Original strand, 42471411 - 42471548
Alignment:
| Q |
16 |
tttttaagcataaaatttaaaatcataggcatgggagtaaactttttacaagtaaaaacatatgagaaaataagtccacttatcatatgtcggatatgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42471411 |
tttttaagcataaaatttaaaatcataggcatgggagtaaactttttacaagtaaaaacat--gagaaaataagtccacttatcatatgtcggatttgaa |
42471508 |
T |
|
| Q |
116 |
gttgactatgttgcgttgtgaacttaacactttcaattag |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42471509 |
gttgactatgttacgttgtgaacttaacactttcaattag |
42471548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 145 - 265
Target Start/End: Original strand, 42473732 - 42473852
Alignment:
| Q |
145 |
ctttcaattagtttac-ggtgatgattgatttagggttgtgagcaaatttgaggttttatgtttttattacattattaatgaaatatgtaaataacaatt |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42473732 |
ctttcaattagtttaccggtgatgattgattttgggttgtgagcaaatttgaggttttatgtttt-attacattattaatgaaatatgtaaataacaatt |
42473830 |
T |
|
| Q |
244 |
ctttttcgaaaacttacaatgg |
265 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42473831 |
ttttttcgaaaacttacaatgg |
42473852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University