View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11857_low_24 (Length: 249)
Name: NF11857_low_24
Description: NF11857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11857_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 45588303 - 45588408
Alignment:
| Q |
1 |
taaagtgaaaagttattaggattaactttct---------atttttcttataaaaaataacgaggtaacataaactagttaaaaatcaatttttgttaac |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588303 |
taaagtgaaaagttattaggattaactttctcaaaaatctatttttcttattaaaaataacgaggtaacataaactagttaaaaatcaatttttgttaac |
45588402 |
T |
|
| Q |
92 |
gattga |
97 |
Q |
| |
|
|||||| |
|
|
| T |
45588403 |
gattga |
45588408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 45588498 - 45588555
Alignment:
| Q |
187 |
tgtaattggttgttgtcatttctgttacaggaacttaacttggatggcttcatctcac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45588498 |
tgtaattggttgttgtcatttctgttacaggaacttaacttggatggcttcatatcac |
45588555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University