View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11858_high_13 (Length: 268)
Name: NF11858_high_13
Description: NF11858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11858_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 35 - 260
Target Start/End: Original strand, 12187761 - 12187989
Alignment:
| Q |
35 |
cttgtaacccaacatctttcctctttacctagattcatgctgtaaaa-gttacacacaccc--tcattccatcaaactaatcttaaacgaccctgatacc |
131 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||| ||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12187761 |
cttggaacccaacatctttcttctttacctagattaatgctttaaaaagttacacacaccccctcattccaccaaactaatcttaaacgaccctgatacc |
12187860 |
T |
 |
| Q |
132 |
tttcacctttccgatgataattttagaattaaagtcttatgtacatcatgatatttacatgccctgagtttcatgtaagcacttgtgcaccgaaagttaa |
231 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12187861 |
tttcacctttcagatgataattttagaattaaagacttatgtacatcatgatatttacatgccctgagtttcaagtaagcacttgtgcaccgaaagttaa |
12187960 |
T |
 |
| Q |
232 |
ttaaaattcttgtcatcatcgttcttctc |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
12187961 |
ttaaaattcttgtcatcatcgtccttctc |
12187989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University