View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11858_high_19 (Length: 240)
Name: NF11858_high_19
Description: NF11858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11858_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 169
Target Start/End: Complemental strand, 28519269 - 28519115
Alignment:
| Q |
15 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519269 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttggcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
28519170 |
T |
 |
| Q |
115 |
tagcttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
169 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519169 |
taacttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
28519115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 228
Target Start/End: Complemental strand, 28519089 - 28519056
Alignment:
| Q |
195 |
caatatctacaaattttaagctagagaaaaaatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28519089 |
caatatctacaaattttaagctagagaaaaaatt |
28519056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 63 - 132
Target Start/End: Original strand, 12728763 - 12728832
Alignment:
| Q |
63 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggtattgatt |
132 |
Q |
| |
|
|||||||||| |||| ||||| ||||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12728763 |
ttctcttagctgtcaatggtaatccaataaagtcccatgatcttgttgtgtgtagcttgcggtattgatt |
12728832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 126
Target Start/End: Complemental strand, 34291425 - 34291362
Alignment:
| Q |
63 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggta |
126 |
Q |
| |
|
|||||||||| |||| |||||| ||||| || | |||||||||||||||||||||||| ||||| |
|
|
| T |
34291425 |
ttctcttagctgtcaaaggtaatccaataaaatcccatgatcttgttgtgtgtagcttgcggta |
34291362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University